Classicnewcar.us


Freezing their lungs can help ex-smokers breathe more

Freezing their lungs can help ex-smokers breathe more

Skip to main content Advertisement Login to your account Impact Factor 3.841 We want to know more about our readers. Tell us about yourself in our short survey for a chance to win a MacBook Air. https://doi.org/10.1186/s12931-016-0486-5©  The Author(s). 2017Received: 31 May 2016Accepted: 9 December 2016Published: 5 January 2017Chronic obstructive pulmonary disease (COPD) is a progressive, irreversible chronic inflammatory disorder typified by increased recruitment of monocytes, lymphocytes and neutrophils. Because of this, as well as the convenience of peripheral blood nuclear cells (PBMCs) assessments, miRNA profiling of PBMCs has drawn increasing attention in recent years for various disease. Therefore, we yzed miRNA and mRNA profiles to understand their regulatory network between COPD subjects versus smokers without airflow limitation.miRNA and mRNA profiling of PBMCs from pooled 17 smokers and 14 COPD subjects was detected by high-throughput microarray. The expression of dysregulated miRNAs were validated by q-PCR. The miRNA targets in dysregulated mRNAs were predicted and the pathway enrichment was yzed.miRNA microarray showed that 8 miRNAs were up-regulated and 3 miRNAs were down-regulated in COPD subjects compared with smokers; the upregulation of miR-24-3p, miR-93-5p, miR-320a and miR-320b and the downregulation of miR-1273 g-3p were then validated. Bioinformatic ysis of regulatory network between miRNA and mRNA showed that NOD and TLR were the most enriched pathways. miR-24-3p was predicted to regulate IL-18, IL-1β, TNF, CCL3 and CCL4 and miR-93-5p to regulate IκBα.The expression of miRNA and mRNA were dysregulated in PBMCs of COPD patients compared with smokers without airflow limitation. The regulation network between the dysregulated miRNA and mRNA may provide potential therapeutic targets for COPD.Chronic obstructive pulmonary disease (COPD) is a progressive, irreversible chronic inflammatory disorder. Caused predominantly by cigarette smoking, COPD is one of the leading causes of mortality globally [1]. Although cigarette smoking is the major cause of COPD, there is currently no satisfactory therapy to treat individuals once the disease is established. Inflammation plays a pivotal role in the disease process, with CD8+ T lymphocytes, neutrophils and macrophages being the main type of immune cells of local inflammatory milieu of COPD [2]. Different immunoregulatory properties of T cells and monocytes have been demonstrated in COPD patients [3], and the inflammatory response in the lungs of COPD patients is strongly linked to tissue destruction and alveolar airspace enlargement [4], in part due to the loss of lung structural cells due to heightened apoptosis.microRNAs (miRNAs) are a growing family of small non-coding RNAs (approximately 19 to 25 nucleotides long) with a regulatory function on gene expression [5]. Through binding to the 3′ untranslated region (3′ UTR) of target messenger RNAs, miRNAs can lead to direct inhibition of protein translation or degradation of messenger RNA [5]. In addition, miRNAs can alter gene expression by targeting transcription factors and DNA methyltransferases. In this way, miRNAs work as post-transcriptional regulators of gene expression and control various cellular processes such as differentiation, proliferation, and cell-cell interaction. The dysregulation of miRNAs is linked to a wide spectrum of diseases, including proliferative vascular disease, cardiac disorders, lung diseases, kidney diseases, diabetes mellitus, fibrosis and cancer [6–8].A few studies have been conducted to reveal the dysregulation and role of miRNAs in COPD. Ezzie et al. [9] compared the miRNA expression in lung tissue derived from smokers with and without COPD and identified 70 differentially expressed miRNAs. A report by Pottelberge et al. [10] demonstrated that 34 miRNAs were differentially expressed between never-smokers and current smokers without airflow limitation, and 8 miRNAs were expressed at a significantly lower level in current-smoking patients with COPD compared with never-smokers without airflow limitation. Another study showed that microRNA-34c is associated with emphysema severity in COPD [11]. Sato et al. [12] observed reduced miR-146a expression in lung fibroblasts of patients with COPD and showed that miR-146a deficiency increased the expression of PGE2 through depression of the miR-146a target COX-2. Finally, Lewis et al. [13] found downregulated miR-1 expression in quadriceps muscles and speculated that this is linked to the muscle weakness observed in COPD.On account of the convenience of peripheral blood nuclear cells (PBMC) assessments, the miRNA profiling of PBMC has drawn increasing attention in recent years in various diseases such as cancer [14, 15], Alzheimer’s Disease [16], diabetes [17] and autoimmune disease [18]. However, there is no report regarding miRNA expression profiles of PBMC in COPD patients. Therefore, in this study, we sought to determine if miRNAs were differentially expressed in PBMCs of COPD patients and if miRNA expression may be linked to dysregulated mRNA expression relevant to the pathogenesis of COPD. We yzed miRNA and mRNA expression profiles in PBMCs from COPD patients versus smokers without airflow limitation. The mRNA targets of the dysregulated miRNA were predicted and pathway enrichment was yzed. We identified a signature of COPD-associated miRNA, such that miR-24-3p, miR-93-5p, miR-320a, miR-320b and miR-1273g-3p were significantly dysregulated in COPD patients. Bioinformatic ysis between miRNA and predicted mRNA showed that NOD and TLR were the most enriched pathways. In NOD pathway, miR-24-3p was predicted to regulate IL18/IL1B/TNF, and miR-93-5p to regulate NLRP3/IL6/NFKBIA. In TLR pathway, miR-24-3p was predicted to regulate CCL3/CCL4/IL1B/TNF, and miR-93-5p to regulate IL6/CXCL10/NFKBIA.Clinical characteristics of smokers without airflow limitation and COPD patientsSmokersCOPDNumber1714Age56 ± 1769 ± 8Male/Female17/013/1Current/ex-smokers14/38/6Pack-years23 ± 327 ± 6Post-BD FEV1% predicted92.9 ± 9.029.0 ± 10.6GOLD Stage I-0 II-2 III-IV-12Data are presented as Means ± SD. BD bronchodilator, FEV1 forced expiratory volume in 1 sPBMCs were isolated from venous blood by density gradient centrifugation over Ficoll-Paque PLUS reagent (GE Healthcare, Uppsala, Sweden) and suspended in QIAzol Lysis Reagent (Qiagen, Dusseldorf, Germany). Total RNA was extracted using miRNeasy Mini Kit (Qiagen) according to the manufacturer’s procedure. RNA integrity was determined by formaldehyde denaturing gel electrophoresis.Equal amount of RNA sample from each smokers (N = 17) and COPD patients (N = 14) was pooled respectively for miRNA profiling assay using Affymetrix GeneChip miRNA Array v.4.0 (Affymetrix, Santa Clara, CA, USA) by Capitalbiotech company, Beijing, China. Briefly, after labeled with Biotin, the total RNA was subsequently hybridized overnight. The GeneChip® miRNA 4.0 arrays, containing 30,424 total mature miRNA probe sets including 2,588 mature human miRNAs and miRNAs of 202 other organisms, were washed and stained using the Affymetrix GeneChip Hybridization Wash and Stain Kit and were then scanned with the Affymetrix GeneChip® Scanner 3000 (Affymetrix, Santa Clara, CA, USA).Samples were prepared for mRNA microarray ysis using Agilent Human Gene Expression Microarray V4.0 (Santa Clara, California, USA). Hybridized slides were then washed and scanned with Agilent Microarray Scanner System (G2565CA).The miRNA and mRNA array data were yzed for data summarization, normalization and quality control using GeneSpring V11.5 software (Agilent). To select differentially expressed genes, we used threshold values of >2 fold change. The data were Log2 transformed and median centred by genes using the Adjust Data function of CLUSTER 3.0 software. Further ysis was performed by hierarchical clustering with average linkages. Finally, we performed tree visualization using Java Treeview (Stanford University School of Medicine, Stanford, CA, USA).The sequence of primers for real-time PCRGeneSequence (5′-3′)DirectionIL18GACCAAGGAAATCGGCCTCTAForwardAGTTACAGCCATACCTCTAGGCReverseIL1BCTCTGGGATTCTCTTCAGCCAForwardAATAAGCCATCATTTCACTGGCGReverseTNFGCTGCACTTTGGAGTGATCGForwardGGCCAGAGGGCTGATTAGAGReverseCCL3GCTCTCTGCAACCAGTTCTCTForwardGGCTGCTCGTCTCAAAGTAGTReverseCCL4CTCCCAGCCAGCTGTGGTATTCForwardCCAGGATTCACTGGGATCAGCReverseNLRP3ATGAGAGTGTTGTGTGAAACGCForwardGAGATGTCGAAGCAGCACTCAReverseIL6CAGACAGCCACTCACCTCTTCForwardCAGGTTGTTTTCTGCCAGTGCReverseNFKBIAGTACGAGCAGATGGTCAAGGAForwardGGTCAGTGCCTTTTCTTCATGGReverseCXCL10GCCATTCTGATTTGCTGCCTTForwardACTAATGCTGATGCAGGTACAGReverseβ-actinTACCTCATGAAGATCCTCACCForwardTTTCGTGGATGCCACAGGACReverseThe target genes for miRNAs were predicted using miRanda, MirTarget2, PicTar, PITA and TargetScan. The regulation network diagram between miRNAs and mRNAs was generated using Cytoscape. Based on the data of mRNA array, the predicted target genes that negatively regulated by the validated dysregulated miRNAs were selected for the further pathway enrichment ysis. The DAVID [19] online ysis tool was used and the significant enrichment threshold was P value of Modified Fisher exact less than 0.05 and enriched gene count more than 2.Hierarchical clustering and scatter plot result of differentially expressed miRNAs in PBMCs from smokers and COPD patients. a Hierarchical clustering image of miRNA expression of pooled RNA samples from PBMCs of COPD patients compared to smokers without airflow limitation. b Scatter plot of miRNA expression of PBMCs of COPD patients compared to smokers without airflow limitation. Red and green colored dots represent up- and down- regulated miRNAs in scatter plot, respectivelySelected dysregulated miRNAs in COPD patients compared with smokers without COPDUpregulationDownregulationmiRNAFold changemiRNAFold changehsa-miR-24-3p9.80hsa-miR-3613-3p0.14hsa-miR-93-5p9.73hsa-miR-1273 g-3p0.16hsa-miR-320a5.52hsa-miR-4668-5p0.38hsa-miR-320b4.62hsa-miR-191-5p3.73hsa-let-7b-5p3.43hsa-miR-342-3p2.62hsa-miR-92a-3p2.06The miRNAs with difference of fluorescence intensity higher than 1000 was selectedValidation of differentially expressed miRNAs. a Expression of selected miRNAs in PBMCs of smokers and COPD patients. qRT-PCR was performed on the same RNA samples (17smokers and 14 COPD patients) as microarray ysis. Data are presented as 2(−σσCt) relative to U6. * P < 0.05, ** P < 0.01 compared with smokers by Mann Whitney U test. b Relative abundance of differentially expressed miRNAs in PBMCs of smokers and COPD patients. * P < 0.05, ** P < 0.01 compared with smokers. c Correlation ysis between miRNA expression and FEV1% predictedExpression of miRNAs in the isolated different cell types of PBMCs from smokers (a) and COPD patients (b). The expression of miR-24-3p, miR-93-5p, miR-320a, miR-320b and miR-1273g-3p was examined by qRT-PCR on CD4+ T lymphocytes, CD8+ T lymphocytes, CD20+ B lymphocytes and CD14+ monocytes from smokers and COPD patients. Data are presented as 2(−σσCt) relative to β-actinHierarchical clustering and scatter plot result of differentially expressed mRNAs in PBMCs from smokers and COPD patients. a Hierarchical clustering image of mRNA expression of pooled RNA samples from PBMCs of COPD patients compared to smokers without airflow limitation. b Scatter plot of mRNA expression of PBMCs of COPD patients compared to smokers without airflow limitation. Red and green colored dots represent up- and down- regulated mRNAs in scatter plot, respectivelyTop 10 dysregulated mRNAs in COPD patients compared with smokers without COPDGene symbolGene nameFold changeCOPD/SmokersFunctionUpregulationCD177CD177 molecule22.59Leukocyte migrationMUC17Mucin 17, cell surface associated21.54Extracellular matrix constituentIL1R2Interleukin 1 receptor, type II10.96Decoy receptor, inhibits the activity of IL-1SARDHSarcosine dehydrogenase9.52Mitochondrial matrixEGR3Early growth response 36.75Positive regulation of endothelial cell proliferationAREGAmphiregulin6.16EGF family, promote the growth of normal epithelial cellsSLC6A2Solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 24.70Sodium symporterTMEM167ATransmembrane protein 167A4.55Golgi apparatusKCNJ15Potassium inwardly-rectifying channel, subfamily J, member 154.42Potassium channel activityFCHO1FCH domain only 14.39Clathrin-mediated endocytosisDownregulationIL1AInterleukin 1, alpha−44.69Immune responseIL6Interleukin 6 (interferon, beta 2)−16.14Pro-inflammatory and anti-inflammatory roleCXCL10Chemokine (C-X-C motif) ligand 10−15.08leukocyte chemotaxisTNFTumor necrosis factor−11.79Inflammation, cause apoptosisCCL20Chemokine (C-C motif) ligand 20−7.94Lymphocytes chemotaxisCCL4Chemokine (C-C motif) ligand 4−6.19Leukocyte chemotaxisCCL3L3Chemokine (C-C motif) ligand 3-like 3−5.28Leukocyte chemotaxisC9orf7Chromosome 9 open reading frame 7−5.23Calcium channel activityIL1RNInterleukin 1 receptor antagonist−4.69Inhibition of the activities of IL-1RNF19BRing finger protein 19B−4.17Cytotoxic effects of natural killer (NK) cellsRegulation network between miRNAs and mRNAs. The negatively regulation of miRNA on dysregulated mRNAs was predicted and the regulation network was drawn by using Cytoscape software. Red and green color represents up- and down-regulated genes, respectivelyThe pathway enrichment of dysregulated mRNAs regulated by miRNAsmiRNAPathwayGenesGene Ratio P ValuemiR-24-3pRheumatoid arthritisIL1A/CCL3/CCL3L3/IL18/IL1B/TNF6/162.37E-06African trypanosomiasisHBA2/IL18/IL1B/TNF4/162.47E-05Cytokine-cytokine receptor interactionIL1A/CCL3/CCL4/CCL3L3/IL18/IL1B/TNF7/162.53E-05MalariaHBA2/IL18/IL1B/TNF4/165.74E-05Toll-like receptor signaling pathwayCCL3/CCL4/IL1B/TNF4/160.000645Chagas disease (American trypanosomiasis)CCL3/CCL3L3/IL1B/TNF4/160.000645Graft-versus-host diseaseIL1A/IL1B/TNF3/160.000741Type I diabetes mellitusIL1A/IL1B/TNF3/160.000743Cytosolic DNA-sensing pathwayCCL4/IL18/IL1B3/160.001268NOD-like receptor signaling pathwayIL18/IL1B/TNF3/160.001331miR-320aNatural killer cell mediated cytotoxicityICAM1/KIR2DL2/TNF3/80.018267African trypanosomiasisICAM1/TNF2/80.018267Graft-versus-host diseaseKIR2DL2/TNF2/80.018382MalariaICAM1/TNF2/80.01936RIG-I-like receptor signaling pathwayTANK/TNF2/80.029778Antigen processing and presentationKIR2DL2/TNF2/80.029845Rheumatoid arthritisICAM1/TNF2/80.035321Folate biosynthesisGCH11/80.072257AsthmaTNF1/80.150454Graft-versus-host diseaseGZMB/KIR2DL2/TNF3/70.000379miR-320bGraft-versus-host diseaseGZMB/KIR2DL2/TNF3/70.000379Natural killer cell mediated cytotoxicityGZMB/KIR2DL2/TNF3/70.005999Allograft rejectionGZMB/TNF2/70.008916Type I diabetes mellitusGZMB/TNF2/70.008916Antigen processing and presentationKIR2DL2/TNF2/70.019996Hypertrophic cardiomyopathy (HCM)TNF/TPM12/70.019996Dilated cardiomyopathyTNF/TPM12/70.020091Folate biosynthesisGCH11/70.049597AsthmaTNF1/70.117955African trypanosomiasisTNF1/70.117955miR-93-5pMalariaIL6/ICAM1/THBS13/220.020688Cytosolic DNA-sensing pathwayIL6/CXCL10/NFKBIA3/220.020688NOD-like receptor signaling pathwayNLRP3/IL6/NFKBIA3/220.020688RIG-I-like receptor signaling pathwayCXCL10/NFKBIA/TANK3/220.022958LeishmaniasisIL1A/NFKBIA/PTGS23/220.022958Rheumatoid arthritisIL6/ICAM1/IL1A3/220.036896Toll-like receptor signaling pathwayIL6/CXCL10/NFKBIA3/220.041751African trypanosomiasisIL6/ICAM12/220.041751Prion diseasesIL6/IL1A2/220.041751Bladder cancerCDKN1A/THBS12/220.045977MalariaIL6/ICAM1/THBS13/220.020688Pathway enrichment of dysregulated mRNAs regulated by miRNAs. The pathways in dysregulated mRNAs predicted by miRNAs were enriched by KEGG pathway enrichment ysis. “p adjust” represents the P value range. “Gene Ratio” represents the ratio of predicted target gene number in total gene number of each relevant pathwayValidation of predicted target genes of miRNAs. The expression of predicted target genes of miRNAs in PBMCs of smokers and COPD patients was examined by qRT-PCR. Data are presented as 2(−σσCt) relative to β-actin. * P < 0.05, ** P < 0.01, *** P < 0.001 compared with smokers by Mann Whitney U test.MicroRNAs play important regulatory roles in cell differentiation, cell cycle and apoptosis. Due to the role of multiple gene regulation, miRNAs have received much attention as biomarkers and target for novel therapeutics. In COPD therefore, the role of miRNAs in disease pathogenesis is an attractive area of research. For the first time, we conducted a comprehensive ysis of both miRNA and mRNA expression in PBMCs from subjects with COPD and compared their expression profiles to smokers without airflow limitation. We identified 137 differentially-expressed miRNAs in PBMCs from COPD subjects compared with smokers without COPD. Among the selected 11 miRNAs, the dysregulated expression of 5 miRNAs including miR-24-3p, miR-93-5p, miR-320a, miR-320b and miR-1273g-3p were validated by qPCR.Of the miRNA investigated in this study, miR-24-3p is of considerable interest. It has been reported that miR-24-3p was consistently upregulated during terminal differentiation of hematopoietic cells into a variety of lineages as well as during muscle and neuronal cell differentiation [20, 21]. MiR-24-3p might also function in cell proliferation [22, 23]. Upregulation of miR-24 is associated with a decreased DNA damage response upon etoposide treatment in highly differentiated CD8+ T cells [24], and miR-24 is a negative regulator of classical macrophage activation by LPS [25]. In this study, we found increased expression of miR-24-3p mainly in the T lymphocytes and monocytes, which might in part contribute to the increased number of CD8+ T cells in the lung [26] and to the impairment of host defenses in the lower respiratory tract due to the smoke related changes in the phenotype of alveolar macrophages of COPD patients [27].As for the rest of dysregulated miRNAs reported in this study, we did not find the relevant evidences involving the pathogenesis of COPD, which implies the discrepancy of the miRNA profile between PBMCs and lung tissues. These miRNAs were mainly found dysregulated in cancers and other disorders like autoimmune diseases. For example, miR-93-5p was identified as a potential biomarker of various types of cancer such as acute myeloid leukemia [28] and laryngeal squamous cell carcinoma [29]. This could be due to the link between miR-93 and promotion of tumor growth, angiogenesis and metastasis [30, 31]. miR-93 is up-regulated in PBMCs from adult T-cell leukemia patients, and suppresses the expression of a tumor suppressor protein, tumor protein 53-induced nuclear protein 1 (TP53INP1) [32]. Four different transcripts have been reported in the database for miR-320 (miR-320a, b, c, and d) [33]. The seed region considered crucial for target binding remains the same for miR-320a, b, c, and d. The plasma level of miR-320a was found increased in patients with systemic lupus erythematosus (SLE) [34], and miR-320-3p is increased in the plasma of non-small cell lung cancer (NSCLC) patients [35]. The expression of miR-1273g-3p was found remarkably changed in Human Umbilical Vein Endothelial Cells (HUVECs) under acute glucose fluctuations, which was demonstrated to contribute to endothelial dysfunction and autophagy [36]. MiR-1273 expression is also increased in the pancreas of mouse model of pancreatic cancer [37].By yzing the regulation network between the dysregulated miRNA and mRNA, we predicted the negative regulatory role of miRNAs on a total of 36 over expressed and 61 under expressed mRNAs. The KEGG pathway enrichment ysis indicated that the NOD − like receptor (NLR) signaling pathway and Toll − like receptor (TLR) signaling pathway are the top 2 pathways likely involved in the pathogenesis of COPD, with mir-24-3p and miR-93-5p being predicted to regulate the relevant genes in both pathways. As down-stream factors of the NLR and TLR pathway, the mRNA levels of pro-inflammatory mediators including IL-18, IL-1β, CCL3, CCL4, and TNF were found down-regulated in PBMCs of COPD patients in this study. To the best of our knowledge, the down-regulation of these mRNAs in PBMCs of COPD patients has not been previously reported. In fact, a previous study performed on human peripheral lung tissue obtained from non-smokers, smokers and COPD patients revealed the similar trends of expression level of pro-inflammatory mediators, where the level of IL-8, IL-6, IL-1β and TNF-α showed the decreased trend in COPD patients compared with smokers [38]. Instead, most previous studies showed elevated expression levels of these mediators in serum or lung [39]. We suspect that certain changes in the cytokine expression profile may happen when the peripheral immune cells infiltrate the local inflammatory sites in the lung. The reduced expression of TLR2 has been found in the alveolar macrophages of smokers and COPD patients, which was associated with the impairment of host defenses in the lower respiratory tract [27]. Furthermore, decreased cytokine and chemokine mRNA expression in bronchoalveolar lavage cells from asymptomatic smokers has been reported [40].In addition, NFKBIA predicted to be regulated by miR-93-5p- was the other down-regulated gene involved in enriched pathways. In unstimulated cells, NF-κB is found in the cytoplasm in an inactive non-DNA binding form, associated with its inhibitory protein κBα (IκBα, coded by NFKBIA gene), IκBα degradation unmasks the nuclear localization signal present in NF-κB, allowing it to enter the nucleus, bind DNA, and initiate gene transcription [41]. In the present study, the down-regulation of IκBα supposedly trigger the activation of NF-κB, whose expression was also higher in PBMCs of COPD patients. The coexistence of decreased level of IκBα and pro-inflammatory mediators in COPD patients was also reported on lung tissue [38]. Besides trigging the expression of pro-inflammatory mediators, NF-κB activation may also be related with the disordered apoptosis of T-cell hybridoma cell line [42]. Thus, the decreased expression of IκBα may contribute to the dysregulated apoptosis of T cells in COPD [43].Overall, through miRNAs and mRNAs expression profiling in smokers and COPD patients, we identified the dysregulated miRNAs and mRNAs in PBMCs from COPD patients. We further yzed the regulation network between miRNA and mRNA, where NLR and TLR was the most enriched pathways. Among them the regulation of IL-18, IL-1β, TNF, CCL3 and CCL4 by miR-24-3p, and IκBα by miR-93-5p may provide the clue for potential investigations.The expression of miRNA and mRNA were dysregulated in PBMCs of COPD patients compared with smokers without airflow limitation. The regulation network between the dysregulated miRNA and mRNA may provide potential therapeutic targets for COPD.Chronic obstructive pulmonary diseaseNOD − like receptorPeripheral blood mononuclear cellToll − like receptorThe authors acknowledge Dr. Yong-Ping Shao and Dr. Wuyuan Lu for their critical revise on mcript and valuable suggestions on study.This study was supported by National Natural Science Foundation of China (31501044), Natural Science Basic Research Plan in Shaanxi Province of China (2015JQ3066), Sci-tech Research and Development Project of Shaanxi Province of China (2016KW-026), Fundamental Research Funds for the Central Universities (xjj2014088), the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry and the Richard and Edith Strauss Canada Foundation. This work was supported in part by Project 985 of Xi’an Jiaotong University.Not applicable.XD collected blood samples. XQ isolated PBMCs, performed qRT-PCR and cell culture and yzed the data. WW isolated part of PBMCs. CL helped collecting blood samples. YL performed part of cell culture. DX coordinated the collection of blood samples. CJB revised the mcript. DS collected blood samples. YC designed the study and drafted the mcript. All authors read and approved the final mcript.The authors declare that there have no competing interests.Not applicable.The experimental procedures were performed with ethical approval from the Research Ethics Boards of The First Affiliated Hospital, Xi’an Jiaotong University (2015–015). Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Download PDF AdvertisementISSN: 1465-993XBy continuing to use this website, you agree to our Terms and Conditions, Privacy statement and Cookies policy.© 2017 BioMed Central Ltd unless otherwise stated. Part of Springer Nature. We use cookies to improve your experience with our site. More information about our cookie policy



A new study in the New England Journal of Medicine finds that smokers, who wouldn't typically be diagnosed with chronic obstructive pulmonary disease, or COPD, are still showing symptoms consistent with the diagnosis. According to the Centers for Disease Control and Prevention, COPD is the third-leading cause of death in the United States with tobacco smoke being a key factor in its cause.COPD causes breathing-related problems and blockage of airflow in the body. Symptoms of the disease include shortness of breath, coughing, difficulty exercising and history of asthma. It's diagnosed using spirometry, a breathing test that checks how well your lungs can inhale and exhale.Researchers looked at spirometry data and respiratory symptoms of more than 2,700 patients, including current or former smokers, as well as individuals who never smoked. They found that about half of current or former smokers experienced respiratory symptoms similar to COPD, as well as an increased risk for flare-ups in their symptoms, even though their lungs seemed to function normally according to the spirometry test results.Meilan Han, M.D., one of the lead authors of the study, an associate professor of internal medicine at the University of Michigan, and the medical director of the U-M Women's Respiratory Health Program, explains more about the results.What is the most important takeaway from the study?Han: We found that a significant number of current and former smokers who don't meet the typical criteria for COPD (based on a breathing test)otherwise look and behave like patients who do carry a diagnosis of COPD.Can you expand on that finding?Han: Specifically, we found significant respiratory symptoms in half of the current or former smokers with technically "normal" breathing tests. We also found that these individuals needed to seek medical attention for breathing flare-ups with similar frequency as some patients who actually meet criteria for a diagnosis of COPD.How do you think this study will benefit this patient group in the future?Han: My hope is that it will generate more research on this group of patients, as clinically they have evidence of disease, but we have no name for the condition. At the University of Michigan, we will actually be leading a National Institutes of Health-sponsored trial to study use of a bronchodilator medication in this patient population to understand if this type of medication actually helps improve symptoms. This will be the first step towards providing some guidance for physicians on how to treat these patients.Do you think this study points out that the definition of COPD should be adjusted?Han: That's a great question. I think we do need a name for this condition so we can define these patients and develop treatments. However, it's still unclear whether these patients have "early" COPD, in that they will ultimately progress to airflow obstruction that we can detect on a breathing test. More information is still needed.Why did you want to study this topic/specific patient base?Han: Clinically, this is an important group of patients that we as physicians currently have no guidance on how to treat. A significant percentage of these symptomatic smokers with "normal" breathing tests had been given respiratory medications by their doctors to treat their symptoms, but this is a group of individuals that has never really been studied with those medications in clinical trials. Therefore physicians really have no evidence base to guide decision making.Why should the general public care about this topic?Han: Given how common smoking is, everyone likely knows someone who suffers the condition we describe here. As these patients may require medical treatment and in some cases even hospitalization, the impact of this condition is very real. This study is just the first step in trying to better identify these patients so we can develop targeted treatments. Explore further: Screening for COPD not recommended More information: Prescott G. Woodruff et al, Clinical Significance of Symptoms in Smokers with Preserved Pulmonary Function, New England Journal of Medicine (2016). DOI: 10.1056/NEJMoa1505971 Journal reference: New England Journal of Medicine Provided by: University of Michigan Health System Please sign in to add a comment. Registration is free, and takes less than a minute. Read more Enter your Science X account credentialsConnect© Medical Xpress 2011 - 2017, Science X network





#Contact US #Terms of Use #Privacy Policy #Earnings Disclaimer